مــــنتدى كلـــــــمة



 
الرئيسيةالرئيسية  قمة الحب & LoVeقمة الحب & LoVe  اليوميةاليومية  مكتبة الصورمكتبة الصور  بحـثبحـث  التسجيلالتسجيل  دخولدخول  

الدكتورة أميرة
أميرة حبية خالوا
يوسف حبيب خالوا
محمد حبيب عمته حبيبة

سما حبيبة عمو


شاطر | 
 

 اختبار شامل 2

اذهب الى الأسفل 
كاتب الموضوعرسالة
Admin
مـــدير المنتـــــدى
مـــدير المنتـــــدى
avatar

عدد المساهمات : 825
تاريخ التسجيل : 03/04/2009

مُساهمةموضوع: اختبار شامل 2   الخميس 20 مايو 2010, 5:38 am

بسم الله الرحمن الرحيم


امتحان شامــل – أحيـــاء الثانــويه العامــه

مستوىA : اجب عن خمسه أسئله فقط الزمــن : 3 ساعــات

------------------------------------------------------------------------------------------------------

السؤال الأول ملحوظه : هذا الامتحان فى أربع صفحات

أ ) اختر الاجابه الصحيحه ثم انقلها فقط فى ورقه اجابتك :

  • العضو الذى يتم بداخله صنع ماده اليوريا هو ..........


أ- الكليتان ب- الكبد جـ- الرئتان د- الجلد

  • عندما تقوم خلايا العضلات بنشاط عنيف تتراكم بها نسبه عاليه من ..........


أ- حمض البيروفيك ب- حمض الستريك جـ- كحول ايثيلى د- حمض اللاكتيك

  • يدخل عنصر اليود فى تركيب هرمون ..........


أ- الباراثورمون ب- الكالسيتونين جـ- الثيروكسين د- الأدرينالين

  • يحدث الاخصاب للبويضه فى الانسان داخل ..........


أ- المبيض ب- قناه فالوب جـ- الرحم د- المهبل

  • ماده الميلين التى تغلف محاور الخلايا العصبيه عباره عن طبقه من ..........


أ- ماده دهنيه ب- ماده بروتينيه جـ- ماده نشويه د- كل ما سبق

  • تتصل الاحماض الامينيه ببعضها فى جزىء البروتين بواسطه روابط ..........


أ- هيدروجينيه ب- تساهميه جـ- أيونيه د- ببتيديه

  • وراثه عمى الالوان فى الانسان مثال لحاله ..........


أ- ارتباط جنسى ب- وراثه متأثره بالجنس جـ- سياده تامه د- سياده غير تامه

  • عند ملامسه الصفائح الدمويه لسطح خشن أو تعرضها للهواء يتحرر فى الدم ماده ..........


أ- الثرومبوبلاستين ب- الفبرينوجين جـ- البروثرومبين د- الثرومبين

ب ) 1. وضح بالرسم فقط والبيانات : ميكانيكيه حدوث عمليه الشهيق ؟

2. خاصيه الضغط الجذرى أثرها محدود فى صعود العصاره لقمم الاشجار – ناقش العباره باختصار ؟

ج ) قارن بين كل مما يأتى :

  • القوس الانعكاسى الارادى والقوس الانعكاسى اللاارادى .
  • الطفره الجسديه والطفره المشيجيه .
بقيه الأسئله فى صفحه - 2 -
- 2 -


------------------------------------------------------------------------------------------------------

السؤال الثانى

أ ) اكتب المفهوم العلمى فقط فى ورقه اجابتك :

  • أوعيه دقيقه مجهريه تصل بين التفرعات الشريانيه الدقيقه والتفرعات الوريديه الدقيقه
  • ربط وقطع قناتى فالوب أو الوعائين الناقلين كوسيله لمنع الحمل
  • جينات لو وجدت بصوره نقيه أو متماثله تسبب تعطيل النمو لربع النسل غالبا
  • أول مركب عضوى ثابت كيميائيا ينتج من عمليه البناء الضوئى
  • جزيئات DNA الصغيره الدائريه الموجوده فى أوليات النواه ولها دور فى الهندسه الوراثيه
  • عظمه ظهريه مفلطحه ومثلثه الشكل توجد فى الحزام الصدرى


ب ) 1. أكتب موضع ووظيفه كل مما يأتى :

أ- غده البروستاتا ب- جزر لانجرهانز

2. وضح بالرسم فقط والبيانات : مرحله نضج البويضه فى الانسان ؟

ج ) افحص الشكل المقابل ثم أجب عن الأسئله :

  • ما الايونات التى يمثلها رقم 3 ؟ وما دورها فى التشابك العصبى ؟
  • ما اسم الماده رقم 6 ؟ وما مصيرها بعد انتهاء عملها ؟
  • ما اسم رقم 4 و رقم 7 ؟ وماذا يحدث لرقم 7 عند اثارته ؟
  • ما اتجاه السهم الصحيح 1 أم 2 ؟ مع التفسير ؟


السؤال الثالث

أ ) علل لما يأتى باختصار :

  • وجود تحززات كثيره فى بطانه الامعاء الغليظه
  • ندره حدوث التضاعف الصبغى فى الحيوان
  • يمكن نقل t-RNA بين الكائنات الحيه بأمان ولا يمكن نقل m-RNA بنفس الأمان
  • لا توجد ذكور حامله لمرض الهيموفليا و مرض الصلع المبكر
  • يسمع الطبيب صوتين مختلفين لضربات القلب بالسماعه


ب ) 1. ما المقصود بكل مما يأتى :

أ- زراعه الأنسجه ب- الجينات المتكامله
بقيه الأسئله فى صفحه - 3 -
- 3 -


------------------------------------------------------------------------------------------------------

بقيه السؤال الثالث :

2. مم يتكون العصير المعدى ؟ وما دوره فى الهضم ؟

ج ) ارسم الجهاز المستخدم فى تجربه لاثبات أن النبات الأخضر يتنفس ؟ اذكر المشاهده والاستنتاج ؟

السؤال الرابع :

أ ) انقل العبارات الآتيه فى ورقه اجابتك مع تصويب ما تحته خط :

  • ينتج فى التنفس الخلوى الهوائى داخل الميتوكوندريا عدد 38 ATP
  • عند زياده هرمون النمو عن نسبته الطبيعيه بعد البلوغ تنشأ حاله القزامه
  • عندما يصعب تمييز المحيطين الخارجيين لزهره يسمى المحيطان معا بالنوره
  • تبدأ الدوره الرئويه الصغرى من الأذين الايمن وتنتهى فى الاذين الايسر
  • النسب الانعزاليه فى حاله انعدام السياده 3 : 1
  • عند التقاء عظمتى الحرقفه بالورك يوجد التجويف الاروح لتتصل بع رأس عظمه الفخذ
  • يتم اتصال سيتوبلازم الانابيب الغرباليه بعضها ببعض عن طريق الخلايا المرافقه
  • العالم الذى أكتشف وجود صمامات الأورده هو العالم مالبيجى


ب ) اذا كان ترتيب القواعد فى أحد شريطى الجين كالتالى :

TACAGGTTACCCGGGAGATTAATT … ...

  • أكتب شريط m-RNA المنسوخ من الشريط السابق ؟


وحدد عليه الطرف 5 والطرف 3 ؟ مع التعليل ؟

  • اذا كان التتابع الذى تحته خط موقع تعرف انزيم القصر ويتم القطع بين CG فهل من الممكن استخدام انزيم القصر هذا فى استنتاخ تتابعات DNA ؟ مع التفسير ؟


ج ) اعطيت فقط زجاجتين بهما سلالتين لبذور نبات ما كلاهما أخضر اللون ( علما بأن اللون الاخضر سائد )

كيف تميز أى من الزجاجتين بها بذور نقيه وأى منهم بها بذور هجين ؟ فسر وراثيا ؟

السؤال الخامس :

أ ) ماذا يحدث فى الحالات الأتيه باختصار :

  • اصابه النخاع المستطيل اصابه بالغه الشده
  • توقف الكبد عن افراز ماده الهيبارين
بقيه الأسئله فى صفحه - 4 -
- 4 -


------------------------------------------------------------------------------------------------------

  • دخول ايونات الصوديوم بكميه كبيره داخل الليفه العصبيه
  • تحرر الميروزيتات فى دم مريض مصاب ببلازموديوم الملاريا
  • اختفاء انزيم اللولب من خلايا عظام أحد الاطفال
  • تعريض بويضات الضفدعه لصدمه حراريه


ب ) 1. ما المقصود بالقطعه العضليه ؟ هل حجمها يتغير عند الانقباض ؟ مع التفسير ؟

2. وضح بالرسم فقط والبيانات : تركيب البلاستيده الخضراء ؟

ج ) 1. ما المقصود بالمحتوى الجينى ؟ اكتب نبذه مختصره عنه ؟

2. ما الوحده الوظيفيه لكل مما يأتى :

أ- الكليتين ب- جزىء DNA جـ- الرئتين د- الجلد

السؤال السادس

أ ) اختر من الجدول ( ب ) ما يناسب الجدول ( أ ) ثم انقل العباره كامله :


( أ )
( ب )

1

غشاء المساريقا

تحيط بالمخ والنخاع الشوكى

2

غشاء التامور

يحيط باليطن من الداخل

3

غشاء الرهل

يحيط بالجنين وتخرج منه زوائد اصبعيه لتكوين المشيمه

4

الاغشيه السحائيه

يحيط بالجنين وتلتحم نهايتاه لتكوين الحبل السرى


يربط التواءات اللفائفى ببعضها

يحيط بالقلب لحمايته وتسهيل حركته


ب ) فسر كل مما يأتى باختصار :

  • لا تنتقل المواد الضروريه من دم الانسان الى سائل جهاز الكلى الصناعى
  • يعتبر نبات كثبره البئر من الأمثله النموذجيه للتكائر بتبادل الأجيال
  • يزيد عدد مرات التبول لمريض السكر خاصه فى المساء عند النوم
  • اختيار طحلب النيتيلا بالذات لتجربه اثبات حدوث النقل النشط


ج ) 1. فى الشكل المقابل أى منهم موضع الطرف 3 لجزىء t-RNA

[ 1 أم 2] مع التفسير ؟

2. اكتب نبذه مختصره عن كل مما يأتى :

أ- الثقب الكبير ب- الثمره الكاذبه جـ- البروتينات التركيبيه
انتهت الأسئله
الرجوع الى أعلى الصفحة اذهب الى الأسفل
http://kelma.mam9.com
Admin
مـــدير المنتـــــدى
مـــدير المنتـــــدى
avatar

عدد المساهمات : 825
تاريخ التسجيل : 03/04/2009

مُساهمةموضوع: رد: اختبار شامل 2   الخميس 20 مايو 2010, 5:41 am

أنا عارف ان الخط صغير شوية بس اللى عاوز الامتحان يظظله وينسخه في صفحة word علي الجهاز بتاعه وبالتوفيق يا شباب ربنا معاكو
الرجوع الى أعلى الصفحة اذهب الى الأسفل
http://kelma.mam9.com
 
اختبار شامل 2
الرجوع الى أعلى الصفحة 
صفحة 1 من اصل 1

صلاحيات هذا المنتدى:لاتستطيع الرد على المواضيع في هذا المنتدى
مــــنتدى كلـــــــمة :: المنتديات التعليمية :: الأحياء-
انتقل الى: